A Python package for designing influenza reverse genetics primers using the seamless cloning methods (e.g. Gibson assembly, CPEC assembly).
Project description
# FluGibson

A tool for designing primers to clone influenza polymerase segments from viral cDNA.
# Installation
The installation requires the following packages:
networkx
biopython
pandas (optional)
matplotlib (optional)
From Github:
Download this repository as a Zip file.
Unzip the file.
In your terminal, navigate to the FluGibson directory.
Run command: python setup.py install
From PyPI:
(if applicable) Switch to your proper Python environment.
Run command: pip install FluGibson
Using Conda:
(if applicable) Switch to your proper Python environment.
Run command: conda install FluGibson
# Usage
## Scripted
One way to use FluGibson is to use the provided script in the /examples directory. Copy the script to your working directory.
Create the FASTA formatted files containing the DNA parts that you want to stitch together. For example, you would use the following FASTA definition to stitch the following 3 parts together:
>PART_1 >CATCTATCTCTCTACTGCGAGGCTATTCGACTGGCCGTTACTCGCCGGTACGTAGCTCGGTCTCGATCATCAGTACGTCTACGTGTCGTCGTACTTACACGGTCGCTCGGACTGACGTACGTCTACGTCGTCTGACTGA
>PART_2 >CTACTGTCTGCTGATGGTACGTACGTGAGTACGCGCAGCACAGACACTACTTACTCTCGCGCGAGAGCTATCTACGACTACGTACTCGTCGTACGAGCTGACTGATCGACGTAGCTTGACGTACGTATCACGTACGTATCG
>PART_3 >CAGCTTCGGCGCGATTACTCTACGAGCACGACGCAGCTGTCGCTGTCTGGTCTACGCTAGCGCTACGACTATCGATCAGCGTCGTACTGACGTGACGCGCATCGACGTTCGGACGTCGTCGTCGTACGACGTCTACGATGC
The parts will be joined in the order PART_1–>PART_2–>PART_3.
To produce the CSV file that has all of the primers listed, from the command line, run python compute_primers.py. You will get a CSV file, named all_primers.csv, that will house the primers that you will need to order.
# Changelog
## Version 1.2
Added a class that converts one nucleotide sequence into another, using Gibson assembly primers.