pydna 0.9.4

pydna
=====

|icon1|

|icon2|

|icon3|

|icon4|

|icon5|

|icon6|

|icon7|

|icon8|

|icon9|

|icon10|

|icon11|

Planning genetic constructs with many parts, such as recombinant
metabolic pathways is usually done manually using a DNA sequence editor
which quickly becomes unfeasible as scale and complexity of the
constructions increase.

The Pydna python package provide a human-readable formal description of
cloning and assembly strategies which also allows for automatic computer
simulation and verification.

Pydna provides simulation of:

- restriction digestion
- ligation
- PCR
- primer design
- Gibson assembly
- homologous recombination

A cloning strategy expressed in pydna is complete, unambiguous and
stable. Pydna has been designed to be understandable for biologists with
limited programming skills.

Pydna formalize planning and sharing of cloning strategies and is
especially useful for complex or combinatorial DNA molecule
constructions.

Look at some assembly strategies made in the IPython notebook format
``here <http://nbviewer.ipython.org/github/BjornFJohansson/ypk-xylose-pathways/blob/master/index.ipynb>``\ \_
!

Pydna provide functions for molecular biology using python. Double
stranded DNA sequence classes that make cut and paste cloning and PCR
very simple is provided (see example below). Look at the open access BMC
Bioinformatics publication describing pydna:

[https://raw.githubusercontent.com/BjornFJohansson/pydna/master/BMC\_resized.png
](http://www.biomedcentral.com/1471-2105/16/142/abstract

See an example of pydna usage at the command line below:

::

::

>>> import pydna
>>> seq = pydna.Dseq("GGATCCAAA","TTTGGATCC",ovhg=0)
>>> seq
Dseq(-9)
GGATCCAAA
CCTAGGTTT
>>> from Bio.Restriction import BamHI
>>> a,b = seq.cut(BamHI)
>>> a
Dseq(-5)
G
CCTAG
>>> b
Dseq(-8)
GATCCAAA
GTTT
>>> a+b
Dseq(-9)
GGATCCAAA
CCTAGGTTT
>>> b+a
Dseq(-13)
GATCCAAAG
GTTTCCTAG
>>> b+a+b
Dseq(-17)
GATCCAAAGGATCCAAA
GTTTCCTAGGTTT
>>> b+a+a
Traceback (most recent call last):
File "<stdin>", line 1, in <module>
File "/usr/local/lib/python2.7/dist-packages/pydna/dsdna.py", line 217, in __add__
raise TypeError("sticky ends not compatible!")
TypeError: sticky ends not compatible!
>>>

Notably, homologous recombination and Gibson assembly between linear DNA
fragments can be easily simulated.

Most functionality is implemented as methods for the double stranded DNA
sequence record classes Dseq and Dseqrecord, which are subclasses of the
``Biopython <http://biopython.org/wiki/Main_Page>``\ *
``Seq <http://biopython.org/wiki/Seq>``* and
``SeqRecord <http://biopython.org/wiki/SeqRecord>``\ \_ classes.

Pydna was designed to provide a form of executable documentation
describing a subcloning or DNA assembly experiment. The pydna code
unambiguously describe a sub cloning experiment, and can be executed to
yield the sequence of the of the resulting DNA molecule.

Pydna was designed to semantically imitate how sub cloning experiments
are typically documented in Scientific literature. Pydna code describing
a sub cloning is reasonably compact and meant to be easily readable.

The nine lines of Python below, simulates the construction of a
recombinant plasmid. DNA sequences are downloaded from Genbank by
accession numbers that are guaranteed to be stable.

::

::

import pydna

gb = pydna.Genbank("myself@email.com") # Tell Genbank who you are!

gene = gb.nucleotide("X06997") # Kluyveromyces lactis LAC12 gene for lactose permease.

primer_f,primer_r = pydna.parse(''' >760_KlLAC12_rv (20-mer)
ttaaacagattctgcctctg

>759_KlLAC12_fw (19-mer)
aaatggcagatcattcgag
''', ds=False)

pcr_prod = pydna.pcr(primer_f,primer_r, gene)

vector = gb.nucleotide("AJ001614") # pCAPs cloning vector

from Bio.Restriction import EcoRV

lin_vector = vector.linearize(EcoRV)

rec_vec = ( lin_vector + pcr_prod ).looped()

Pydna might also be useful to automate the simulation of
``sub cloning <http://en.wikipedia.org/wiki/Subcloning>``\ \_
experiments using python. This could be helpful to generate examples for
teaching purposes. Read the
``documentation <https://pydna.readthedocs.org/en/latest/>``\ \_ or the
``cookbook <https://www.dropbox.com/sh/4re9a0wk03m95z4/AABpu4zwq4IuKUvK0Iy9Io0Fa?dl=0>``\ \_
with example files for further information.

An ``on-line <http://pydna-shell.appspot.com/>``\ \_ shell running
Python with pydna is available for experimentation.

Please post a message in the
``google group <https://groups.google.com/d/forum/pydna>``\ \_ for pydna
if you have problems, questions or comments.

Feedback in the form of questions, comments or criticism is very
welcome!

======= ==========
===========================================================================
version date comment ======= ==========
===========================================================================
0.9.3 2015-06-03 Shelve does not work under MacOS under certain
conditions. This release tries to solve this by not specifying file
extensions for the cache files. Two functions are added, pydna.

0.9.2 2015-05-28 pydna\_data\_dir is encoded to a string in **init**.py
instead of unicode. The Popen module does not accept environment
variables that are not strings.

0.9.1 2015-05-26 fixed critical error in the calculation of seguid and
cseguid checksums

0.9.0 2015-05-26 seguid and cseguid are now url safe so they can be part
of urls and file names. Dseqrecord.locus is an alias of Dseqrecord.name
Dseqrecord.accession is an alias of Dseqrecord.id Dseqrecord.definition
is an alias of Dseqrecord.description changed how circular assembly
products are identified to use cseguid. removed proxy handling when
proxy not set in download module. added CHANGELOG.md, currently empty.
environment variable datadir is now pydna\_data\_dir. removed
environmental variable pydna\_dna\_dir. if Dseqrecord is initiated with
a name property that is longer than 16 characters, it is truncated to 16
chars and a warning is issued. Default Dseqrecord name property is "na".
Default Dseqrecord id property is "-". Default Dseqrecord description
property is "@". Dseqrecord **eq** and **ne** methods defined.
Dseqrecord.write now overwrites an old sequence with the same filename
if the primary sequence is the same. Dseqrecord.read now only looks in
current working directory. fixed ipynb\_import test code.

0.8.4 2015-04-17 Bugfix for parsing text files with unicode characters.
0.8.3 ? ? 0.8.2 ? ? 0.8.1 2015-03-07 Bugfix for windows. The data
directory was not created.

0.8.0 2015-02-06 Mapping reads added.

0.7.2 2014-11-21 First public release with the changes from 0.7.0 and
0.7.1. Added a Pretty\_str class to beautify output of strings in the
IPython shell.

0.7.1 not public Short linkers can be incorporated in PCR primers in the
assembly\_primers function.

0.7.0 not public Caching to speed up Amplify, Assembly, download and the
Desqrecord synced method. The data is stored in four shelf files in the
users application directory.

::

amplify.shelf
assembly.shelf
genbank.shelf
synced.shelf

The location is os specific.
See the documentation of appdirs
https://pypi.python.org/pypi/appdirs/1.4.0

0.6.6 new function nopcr.

0.6.5 2014-07-31 bugfix: cutting an amplicon object now preserves
features Changed requirement for NetworkX to 1.8.1

0.6.4 2014-07-09 The pcr function and Anneal class can now deal with
primers with ambiguous codons like R = A or G. In the resulting PCR
product, the ambiguous nucleotides are preserved in the tails i.e. the
primer part not annealing. The annealing part will have the sequence
corresponding to the template.

0.6.3 2014-07-06 Dseqrecord.add\_feature can now take a string or some
other sequence as input. The assembly primers function can now produce
primers for a circular assembly.

0.6.2 2014-06-13 Dseqrecord gained three new methods:

::

isorf() method returning True or False.

List_features() method returns a list of all features as a
formatted ASCII table.

Extract_feature() extracts a feature in the form os a new
Dseqrecord object.

Changes to how the primer_design functions work, especially
assembly primers.

0.6.1 2014-04-25 Fixed a bug in the Dseqrecord synced method and removed
the utils synced function.

0.6.0 2014-04-18 Bugfixes and improvements in documentation.

0.5.0 2013-12-16 Changes to how the amplify and assembly modules work
the Amplicon and Assembly classes are now subclasses of Dseqrecord.

0.2.2 2013-11-05 bugfix: changed the handling of compound features to
fit with the new version of BioPython (1.62) which is now a requirement.

0.2.1 2013-08-18 ---

0.1.8 2013-06-02 bugfix: changed the SeqFeatures added to PCR products
in the amplify module to a dict of list of strings instead of a dict of
strings.

0.1.7 2013-05-29 Changed the code in amplify.Amplicon to handle features
spanning the origin of circular sequences.

0.1.6 2013-04-22 Changed the behaviour of the find method of the Dseq
object to find substrings that span the origin. Slicing for circular
Dseq objects now works slightly different.

0.1.5 2013-04-18 Changed the setup.py script to permit installation of
the source installer without access to a c compiler.

0.1.4 2013-04-10 Cleaned up some docstrings Renamed Drecord ->
Dseqrecord to be more consistent with Dseq and Biopython Seq/SeqRecord.

::

Changed name of keyword argument for read and parse.
ds=True returns Dseqrecord(s) while ds=False returns
SeqRecords.

0.1.3 2013-04-09 pydna created from Python-dna. ======= ==========
===========================================================================

Installation requirements
=========================

- ``Python 2.7 <http://www.python.org>``\ \_.
- ``ipython>=3.1.0 <https://pypi.python.org/pypi/ipython>``\ \_
- ``biopython >= 1.65 <http://pypi.python.org/pypi/biopython>``\ \_.
- ``networkx >= 1.8.1 <http://pypi.python.org/pypi/networkx>``\ \_.
- ``appdirs >=1.3.0 <https://pypi.python.org/pypi/appdir>``\ \_.
- ``prettytable>=0.7.2 <https://pypi.python.org/pypi/PrettyTable>``\ \_.

Requirements for running tests
==============================

- ``nose>=1.3.4 <https://pypi.python.org/pypi/nose>``\ \_
- ``coverage>=3.7.1 <https://pypi.python.org/pypi/coverage>``\ \_

Python 2.x
----------

This package was developed on and for Python 2.7. Other versions have
not been tested.

Python 3.x
----------

This code has not been tried with Python 3. If there is sufficient
interest, there might be a Python 3 version in the future.

Installation
============

Using Anaconda
--------------

The best way of using Python is to use a distribution such as
``Anaconda <https://store.continuum.io/cshop/anaconda/>``\ \_.

There is a ``conda <https://anaconda.org/bjornfjohansson/pydna>``\ \_
package available for pydna, which is easily installed at the command
line using the conda package manager. ::

conda install -c https://conda.anaconda.org/bjornfjohansson pydna

This works on Windows, MacOSX and Linux, and installs all dependencies
automatically in one go.

PIP
---

The second best way of installing pydna is with pip. Pip is the
officially
``recommended <http://python-packaging-user-guide.readthedocs.org/en/latest/>``\ \_
tool for installaion of Python packages from PyPi. Pip installs
dependencies automatically.

Linux: ::

bjorn@bjorn-UL30A:~/Dropbox/pydna$ sudo pip install pydna

Windows: ::

C:> pip install pydna

If you do not have pip, you can get it by following these
``instructions <http://www.pip-installer.org/en/latest/installing.html>``\ \_.

Source
------

If you install from source, you need to install the dependencies (listed
above). Download one of the source installers from the pypi site and
extract the file. Open the pydna source code directory (containing the
setup.py file) in terminal and type:

python setup.py install

Binary distribution
-------------------

There are no binary distributions available.

Windows
-------

Sometimes the dependecies can be difficult to install on windows,
especially Biopython as a C compiler is necessary.

If dependencies have to be installed separately, this can be done using
the binary installers for Windows for those who are not comfortable with
the command line:

================
======================================================== Dependency
Hyperlink ================
======================================================== Python (32,64)
http://www.python.org/download/ Biopython (32)
http://biopython.org/wiki/Download Biopython (64)
http://www.lfd.uci.edu/~gohlke/pythonlibs/#biopython networkx (32,64)
http://www.lfd.uci.edu/~gohlke/pythonlibs/#networkx ================
========================================================

Source Code Repository
----------------------

Pydna is hosted by `Github <https://github.com/BjornFJohansson/pydna>`__

Distribution Structure
======================

README.rst -- This file.

LICENSE.txt -- What you can do with the code.

setup.py -- Installation file.

run\_tests.py -- run tests by "python run\_tests.py"

pydna/ -- The main code.

docs/ -- Documentation and cookbook.

scripts/ -- Miscellaneous and perhaps useful scripts and examples.

tests/ -- Testing code.

.. |icon1| image:: https://travis-ci.org/BjornFJohansson/pydna.svg
:target: https://travis-ci.org/BjornFJohansson/pydna
.. |icon2| image:: https://ci.appveyor.com/api/projects/status/qdtk9biw5o0cae7u?svg=true
:target: https://ci.appveyor.com/project/BjornFJohansson/pydna
.. |icon3| image:: https://drone.io/github.com/BjornFJohansson/pydna/status.png
:target: https://drone.io/github.com/BjornFJohansson/pydna/latest
.. |icon4| image:: https://binstar.org/bjornfjohansson/pydna/badges/build.svg
:target: https://binstar.org/bjornfjohansson/pydna/builds
.. |icon5| image:: https://binstar.org/bjornfjohansson/pydna/badges/version.svg
:target: https://binstar.org/bjornfjohansson/pydna
.. |icon6| image:: https://coveralls.io/repos/BjornFJohansson/pydna/badge.svg?branch=master
:target: https://coveralls.io/r/BjornFJohansson/pydna?branch=master
.. |icon7| image:: https://readthedocs.org/projects/pydna/badge/?version=latest
:target: https://readthedocs.org/projects/pydna/?badge=latest
.. |icon8| image:: https://img.shields.io/pypi/v/pydna.png
:target: https://pypi.python.org/pypi/pydna
.. |icon9| image:: https://img.shields.io/github/stars/BjornFJohansson/pydna.svg
:target: https://github.com/BjornFJohansson/pydna/stargazers
.. |icon10| image:: https://img.shields.io/pypi/dm/pydna.png
:target: https://pypi.python.org/pypi/pydna
.. |icon11| image:: https://www.versioneye.com/user/projects/553174c010e714f9e50010bb/badge.svg
:target: https://www.versioneye.com/user/projects/553174c010e714f9e50010bb