Python bindings for UNAFold to determine hybridization energies / folding of RNA/DNA sequences.
Project description
MMseqs2 bindings for Python
This project provides bidings for mmseqs. It's still work in progress. This is the base usage scenario:
import mmseqs
#
# Demonstration of basic mmseqs2 operations
#
# Create a client
client = mmseqs.MMSeqs()
# Create a database from fasta file
# Here we specify name of the database, description and input file
# (The input can also be a Seq/SeqRecord list/iterator/etc.)
client.databases.create("test", "Test database", "a.fasta")
print(client.databases[0].description)
# Perform search on a database
# Note that the search queries can be a string with a patch to the FASTA file with queries
results = client.databases[0].search(
[
"ACTAGCTCAGTCAACTAGCTCAGTCCTCAGTCAACTAGCTCAGTCTATATATATACAAC",
"ACTAGCTCAGTCAACTAGCTCAGTCCTCAGTCAACTAGCT",
"ACTAGCTCAGTCAACTAGCT",
"ACTAGCTCAGT",
],
search_type="nucleotides",
)
# results.records is a list of lists. Each item contains alignments for each query.
# Each list of alignments consists of single result
print(results.records)
Project details
Release history Release notifications | RSS feed
Download files
Download the file for your platform. If you're not sure which to choose, learn more about installing packages.
Source Distribution
mmseqs-0.1.3.tar.gz
(4.2 kB
view hashes)
Built Distributions
Close
Hashes for mmseqs-0.1.3-cp39-cp39-manylinux_2_12_x86_64.manylinux2010_x86_64.whl
Algorithm | Hash digest | |
---|---|---|
SHA256 | b75b8b101b1b3049e5d6a8fc03ba3b66cdceb9487d289ed54460fd97331746e4 |
|
MD5 | 7b2b32b9931294e341c20662372aaf65 |
|
BLAKE2b-256 | ef2fdfde9f6009e568cebe059161e78e13b5ed0c6e8dbc18cbf3cdbf866670fe |
Close
Hashes for mmseqs-0.1.3-cp39-cp39-manylinux_2_12_i686.manylinux2010_i686.whl
Algorithm | Hash digest | |
---|---|---|
SHA256 | 98fa4f09a2c08bfacfed2639f2e4cd18279961f772b099b2627613cbf897cd0f |
|
MD5 | 41c3fd4ade29d013995b1229fc8b8d85 |
|
BLAKE2b-256 | 04b8ed4166b596c79cc88a5da0653822f0931a251ba3f60c64d0253e78bab902 |
Close
Hashes for mmseqs-0.1.3-cp39-cp39-macosx_10_15_x86_64.whl
Algorithm | Hash digest | |
---|---|---|
SHA256 | da9fef483bb18e81bdbabf8e278ac56c3bbdc335a193cda9e7041925599b66e9 |
|
MD5 | a9a3a7d228b952f836ff1906c40ab9ce |
|
BLAKE2b-256 | 690dd3e29774a7ff9ce4b893f1b6d21f3c0ba13705aa707295a7f1d12bee8fb4 |
Close
Hashes for mmseqs-0.1.3-cp38-cp38-manylinux_2_12_x86_64.manylinux2010_x86_64.whl
Algorithm | Hash digest | |
---|---|---|
SHA256 | 91173cc141d3d6a539b05c70ee19a56debff8c65bc81026a86944d734a2de790 |
|
MD5 | b2eb4e436c3c3b39d2e33e3a18dc36b5 |
|
BLAKE2b-256 | 0563a00768cc87805699ae9ee650b0df425ad1ad5691dd71edab60d2cea443df |
Close
Hashes for mmseqs-0.1.3-cp38-cp38-manylinux2014_x86_64.whl
Algorithm | Hash digest | |
---|---|---|
SHA256 | 28a54e134b1ffb167dbcc7a745692d3091cb145543e757e59271f7a65a602e1f |
|
MD5 | 287215330d108a80e06ece0e3a5aad83 |
|
BLAKE2b-256 | 5e75e53db46583fb886e8f9ec70842b7839284d074e9cd3bb4b408247a0dc105 |
Close
Hashes for mmseqs-0.1.3-cp38-cp38-manylinux2010_i686.manylinux_2_12_i686.whl
Algorithm | Hash digest | |
---|---|---|
SHA256 | 20e1721baff4e6c52a2ef47fa7b6673504e09ea54f7bb037a715891bcdd428ae |
|
MD5 | 8b65988fcd18d6b561b544e97403f3fd |
|
BLAKE2b-256 | 06deebb1b9486babf3f1dc914d42c0f68a65624f894778303c239162e02d859b |
Close
Hashes for mmseqs-0.1.3-cp38-cp38-macosx_10_15_x86_64.whl
Algorithm | Hash digest | |
---|---|---|
SHA256 | 4c1e25e69ae4da405e95388c5eb4f295f96b705121e635900d67aa086eb805ce |
|
MD5 | 0e84d489fa60fe183032e3e732184e66 |
|
BLAKE2b-256 | 62d3ace4885c556b550bf1a524bc8775a015120973a30d7ab1bc03bc624313e2 |