Skip to main content

QUEEN (a Python module to universally program, QUinE, and Edit Nucleotide sequences)

Project description

QUEEN Installation and User Manual

QUEEN (a framework to generate quinable and efficiently editable nucleotide sequence resources) is a Python programming module designed to describe, share credit DNA building processes and resources. DNA parts information can be imported from external annotated DNA files (GenBank and FASTA format). Output file (GenBank format) encodes the complete information of the constructed DNA and its annotations and enables the production of a quine code that self-reproduces the output file itself. In QUEEN, all of the manipulations required in DNA construction are covered by four simple operational functions, "cutdna", "modifyends", "flipdna", and "joindna" that can collectively represent any of the standard molecular DNA cloning processes, two search functions, "searchsequence" and "searchfeature", and two super functions, "editsequence" and "editfeature". A new DNA can be designed by programming a Python script or using Jupyter Notebook, an interactive Python programming interpreter. The designed DNA product can be output in the GenBank file format that involves the history of its building process. The "quinable" feature of a QUEEN-generated GenBank file certifies that the annotated DNA material information and its production process are fully transparent, reproducible, inheritable, and modifiable by the community.

Software dependency

Python 3.7.0 or later

Installation

  1. Install QUEEN using the following command.
    pip3 install git+https://github.com/yachielab/QUEEN.git

  2. Install Graphviz (optional; required for visualizing flowcharts of DNA building processes using the visualizeflow() function described below). Graphviz package is available at the following link.

Usage

QUEEN provides the QUEEN class to define a double-stranded (ds)DNA object with sequence annotations. The QUEEN class and its operational functions are described below. Jupyter Notebook files for all of the example codes are provided in ./demo/tutorial of QUEEN (https://github.com/yachielab/QUEEN) and also made executable in Google Colaboratory:

QUEEN class

The QUEEN class can define a dsDNA object with sequence annotations. It can be created by specifying a DNA sequence or importing a sequence data file in GenBank or FASTA file format (single sequence entry). When a GenBank format file is imported, its NCBI accession number, Addgene plasmid ID, or Benchling share link can be provided instead of downloading the file to your local environment.

Example code 1: Create a QUEEN class object (blunt-ends)

A QUEEN_object (blunt-end) is created by providing its top-stranded sequence (5’-to-3’). By default, the DNA topology will be linear.
(Expected runtime: less than 1 sec.)

Source code

from QUEEN.queen import *
dna = QUEEN(seq="CCGGTATGCGTCGA") 

Example code 2: Create a QUEEN class object (sticky-end)

The left and right values separated by "/" show the top and bottom strand sequences of the generating QUEEN_object, respectively. The top strand sequence is provided in the 5’-to-3’ direction from left to right, whereas the bottom strand sequence is provided in the 3′-to-5′ direction from left to right. Single-stranded regions can be provided by "-" for the corresponding nucleotide positions on the opposite strands. A:T and G:C base-pairing rule is required between the two strings except for the single-stranded positions.
(Expected runtime: less than 1 sec.)

Source code

from QUEEN.queen import *
dna = QUEEN(seq="CCGGTATGCG----/----ATACGCAGCT") 

Example code 3: Create a circular QUEEN class object

The sequence topology of generating QUEEN_object can be specified by "linear" or "circular".
(Expected runtime: less than 1 sec.)

Source code

from QUEEN.queen import *
dna = QUEEN(seq="CCGGTATGCGTCGA", topology="circular") 

Example code 4.1: Create a QUEEN class object from a GenBank file in a local directory

GenBank file can be loaded by specifying its local file path.
(Expected runtime: less than 1 sec.)

Source code

from QUEEN.queen import *
pUC19 = QUEEN(record="./input/pUC19.gbk")

Example code 4.2: Create a QUEEN class object using a NCBI accession number

QUEEN_object can be generated from a NCBI accession number with dbtype="ncbi".
(Expected runtime: less than 1 sec.)

Source code

from QUEEN.queen import *
#"M77789.2" is NCBI accession number for pUC19 plasmid
pUC19 = QUEEN(record="M77789.2", dbtype="ncbi") 

Example code 4.3: Create a QUEEN class object using an Addgene plasmid ID

QUEEN_object can be generated from an Addgene plasmid ID with dbtype="addgene".
(Expected runtime: less than 1 sec.)

Source code

from QUEEN.queen import *
#"50005" is Addgene plasmid ID for pUC19 plasmid
pUC19 = QUEEN(record="50005", dbtype="addgene")

Example code 4.4: Create a QUEEN class object from a Benchling share link

QUEEN_object can be generated from a Benchling shared link with dbtype="benchling".
(Expected runtime: less than 1 sec.)

Source code

from QUEEN.queen import *
plasmid = QUEEN(record="https://benchling.com/s/seq-U4pePb09KHutQzjyOPQV", dbtype="benchling")

pX330 plasmid encoding a Cas9 gene and a gRNA expression unit is provided in the above example. The QUEEN_object generated here is used in the following example codes in this document.

Properties of QUEEN class objects

  • .project: str
    Project name of QUEEN_object construction. In QUEEN, this property is also used as a dictionary key to access the .productdict described below. If a QUEEN_object is created from a GenBank or FASTA file, its sequence ID will be inherited here. Otherwise, the project name is automatically generated to be unique amongst the existing .productdict keys.

  • .seq: str
    Top strand sequence (5′→3′). This property cannot be directly edited; only the built-in operational functions of QUEEN described below can edit this property.

  • .rcseq: str
    Bottom strand sequence (5′→3′). This property cannot be directly edited; only the built-in operational functions of QUEEN described below can edit this property.

  • .topology: str ("linear" or "circular")
    Sequence topology. When a QUEEN_object is created by loading from a GenBank file, the topology is set according to the description in the GenBank file. Only the built-in operational functions of QUEEN described below can edit this property.

  • .dnafeatures: list of DNAfeature_objects
    When a QUEEN_object is loaded from a GenBank file, .dnafeatures will automatically be generated from the GenBank file's sequence features. Otherwise, .dnafeatures will be an empty list. Each DNAfeature_object with the following attributes provides an annotation for a given range of DNA sequence in a QUEEN_object.

    • .feature_id: str
      Unique identifier. It is automatically determined to each feature when a QUEEN_object is loaded from a GenBank file.
    • .feature_type: str
      Biological nature. Any value is acceptable. The GenBank format requires registering a biological nature for each feature.
    • .start: int
      Start position of DNAfeature_object in QUEEN_object.
    • .end: int
      Start position of DNAfeature_object in QUEEN_object.
    • .strand: int (1 or -1)
      Direction of DNAfeature_object in QUEEN_object. Top strand (1) or bottom strand (-1).
    • .sequence: str
      Sequence of the DNAfeature_object for its encoded direction.
    • .qualifiers: dict
      Qualifiers. When a GenBank file is imported, qualifiers of each feature will be registered here. Qualifier names and values will serve as dictionary keys and values, respectively.

    DNAfeature_object can be edited only by the editfeature() function described below. DNAfeature class is implemented as a subclass of the Biopython SeqFeature class. Therefore, apart from the above attributes, DNAfeature class inherits all the attributes and methods of SeqFeature class. For details about SeqFeature class, see (https://biopython.org/docs/dev/api/Bio.SeqFeature.html)

  • .productdict: dict
    Dictionary for all of the inherited QUEEN_objects used to construct the present QUEEN_object. The .project of each QUEEN_object serves as a key of this dictionary.

Output functions

QUEEN_objects hold a simple set of functions to output its information.

  • .printsequence(start=int, end=int, strand=int, display=bool, hide_middle=int, linebreak=int)

    Returns and displays partial or the entire dsDNA sequence and sequence end structures of QUEEN_object.

    Parameters

    • start: int (zero-based indexing; default: 0)
      Start position of the sequence.
    • end: int (zero-based indexing; default: the last sequence position of QUEEN_object)
      End position of the sequence.
    • strand: int: 1 (top strand only), -1 (bottom strand only), or 2 (both strands) (default: 2)
      Sequence strand(s) to be returned.
    • display: bool (True or False; default: True)
      If True, the output will be displayed in STDOUT.
    • hide_middle: int or None (default: None)
      Length of both end sequences to be displayed.
    • linebreak: int (default: length of the QUEEN_object sequence)
      Length of sequence for linebreak.

    Return

    If strand is 1 or -1, sequence of the defined strand (5’→3’)
    If strand is 2, "str/str": "top strand sequence (5’→3’)/bottom strand sequence (3’→5’)"

    Example code 5: Print a dsDNA object

    (Expected runtime: less than 1 sec.)

    Source code

    from queen import *
    fragment **=** QUEEN(seq**=**"CCGGTATGCG----/----ATACGCAGCT") 
    fragment.printsequence(display=True)
    

    Output

    5′ CCGGTATGCG---- 3′
    3′ ----ATACGCAGCT 5′
    
  • .printfeature(feature_list=list, attribute=list, seq=bool, separation=str, output=str, x_based_index=int)

    Print a tidy data table of annotation features/attributes of QUEEN_object. Default output attributes are "feature_id", "feature_type", "qualifiers:label", "start", "end", and "strand".

    Parameters

    • feature_list: list of DNAfeaure_objects (default: .dnafeatures)
      List of features to be displayed in the output table. If not given, all features held by the QUEEN_object will be the subject.
    • attribute: list of feature attributes (default: ["feature_id", "feature_type", "qualifiers:label", "start", "end", "strand"]) List of feature attributes to be displayed in the output table. If the value is "all", it will generate a table for all the attributes held by the QUEEN_object except for "sequence".
    • seq: bool (True or False; default: False)
      If True, the sequence of each feature for its encoded direction will be displayed in the output table.
    • separation: str (default: space(s) to generate a well-formatted table)
      String to separate values of each line.
    • output: str (default: STDOUT)
      Output file name.
    • x_based_index: 0 or 1 (default: 0)
      As a default, positions of all features are given in the zero-based indexing in QUEEN (same as Python). If this parameter is set to 1, they will be shown in the 1-based indexing (as seen in the GenBank format).

    Return

    None

    Example code 6: Print DNA features in a well-formatted table

    (Expected runtime: less than 1 sec.)

    Source code

    from queen import *
    plasmid = QUEEN(record="input/px330.gb") 
    plasmid.printfeature()
    

    Output

    feature_id  feature_type   qualifier:label     start  end   strand  
    1           source         source              0      8484  +       
    100         primer_bind    hU6-F               0      21    +       
    200         promoter       U6 promoter         0      241   +       
    300         primer_bind    LKO.1 5'            171    191   +       
    400         misc_RNA       gRNA scaffold       267    343   +       
    500         enhancer       CMV enhancer        439    725   +       
    600         intron         hybrid intron       983    1211  +       
    700         regulatory     Kozak sequence      1222   1232  +       
    800         CDS            3xFLAG              1231   1297  +       
    900         CDS            SV40 NLS            1303   1324  +       
    1000        CDS            Cas9                1348   5449  +       
    1100        CDS            nucleoplasmin NLS   5449   5497  +       
    1200        primer_bind    BGH-rev             5524   5542  -       
    1300        polyA_signal   bGH poly(A) signal  5530   5738  +       
    1400        repeat_region  AAV2 ITR            5746   5876  +       
    1500        repeat_region  AAV2 ITR            5746   5887  +       
    1600        rep_origin     f1 ori              5961   6417  +       
    1700        primer_bind    F1ori-R             6048   6068  -       
    1800        primer_bind    F1ori-F             6258   6280  +       
    1900        primer_bind    pRS-marker          6433   6453  -       
    2000        primer_bind    pGEX 3'             6552   6575  +       
    2100        primer_bind    pBRforEco           6612   6631  -       
    2200        promoter       AmpR promoter       6698   6803  +       
    2300        CDS            AmpR                6803   7664  +       
    2400        primer_bind    Amp-R               7021   7041  -       
    2500        rep_origin     ori                 7834   8423  +       
    2600        primer_bind    pBR322ori-F         8323   8343  +     
    
  • .outputgbk(output=str)

    Output QUEEN_object to a GenBank file. In addition to all of the DNAfeature_objects in the input QUEEN_object, a DNAfeature_object encoding the entire construction processes that generated the QUEEN_object in qualifiers:building_history will also be output to the GenBank file.

    Parameter
    • output: str (default: STDOUT) Output file name.
    Return

    None

Search Function

QUEEN_objects hold .searchsequene() and .searchfeature() functions that enables users to search for query sequences and values in DNAfeature_objects.

  • .searchsequence (query=regex or str, start=int, end=int, strand=int, product=str, process_name=str, process_description="str")

    Search for specific sequences from a user-defined region of a QUEEN_object and return a list of DNAfeature_objects. Start and end attributes of returned DNAfeature_objects represent the sequence regions of the QUEEN_object that matched the user's query. Note that the returned DNAfeature_objects will not be generated with .feature_id and reflected to the parental QUEEN_object**. **The returned DNAfeature_objects can be added to QUEEN_object.dnafeatures by editfeature() with the createattribute option as explained below.

    Parameters

    • query: regex or str (default: ".+")
      Search query sequence. If the value is not provided, the user-specified search region of the QUEEN_object sequence with start and end explained below will be returned. It allows fuzzy matching and regular expression. For details, see https://pypi.org/project/regex/. All IUPAC nucleotide symbols can be used. Restriction enzyme cut motif representation can be used to define a query with "^" and "_" or "(int/int)". For example, EcoRI cut motif can be provided by "G^AATT_C", where "^" and "_" represent the cut positions on the top and bottom strands, respectively, or by "GAATTC(-5/-1)" or "(-5/-1)GAATTC", where the left and right integers between the parentheses represent the cut positions on the top and bottom strands, respectively. Similarly, the cut motif of a Type-IIS restriction enzyme BsaI can be given by "GGTCTCN^NNN_N", "N^NNN_NGAGACC", "GGTCTC(1/5)" or "(5/1)GAGACC". The returned DNAfeature_objects obtained for a query restriction enzyme cut motif will hold the cutting rule in the "qualifiers:cutsite" attribute, which can be added to QUEEN_object.dnafeatures by editfeature() with the createattribute option as explained below. Regular expression is disabled for restriction enzyme cut motifs.
    • start: int (zero-based indexing; default: 0)
      Start position of the target range of the QUEEN_object sequence for the search.
    • end: int (zero-based indexing; default: the last sequence position of QUEEN_object)
      End position of the target range of the QUEEN_object sequence for the search.
    • strand: int: 1 (top strand only), -1 (bottom strand only), or 2 (both strands) (default: 2)
      Sequence strand to be searched.

    Return

    list (list of DNAfeature_objects)

    Example code 7: Search for a DNA sequence motif with regular expression

    (Expected runtime: less than 1 sec.)

    Source code (continued from the previous code)

    match_list = plasmid.searchsequence(query="G[ATGC]{19}GGG")
    plasmid.printfeature(match_list, seq=True, attribute=["start", "end", "strand"])
    

    Output

    start  end   strand  sequence                 
    115    138   +       GTAGAAAGTAATAATTTCTTGGG  
    523    546   +       GACTTTCCATTGACGTCAATGGG  
    816    839   +       GTGCAGCGATGGGGGCGGGGGGG  
    1372   1395  +       GACATCGGCACCAACTCTGTGGG  
    1818   1841  +       GGCCCACATGATCAAGTTCCGGG  
    3097   3120  +       GATCGGTTCAACGCCTCCCTGGG  
    3300   3323  +       GCGGCGGAGATACACCGGCTGGG  
    3336   3359  +       GAAGCTGATCAACGGCATCCGGG  
    3529   3552  +       GGCAGCCCCGCCATTAAGAAGGG  
    3577   3600  +       GACGAGCTCGTGAAAGTGATGGG  
    ︙
    493    516   -       GCGTTACTATTGACGTCAATGGG  
    654    677   -       GTCCCATAAGGTCATGTACTGGG  
    758    781   -       GGTGGGGAGGGGGGGGAGATGGG  
    1014   1037  -       GCGCGAGGCGGCGGCGGAGCGGG  
    1301   1324  -       GACCTTCCGCTTCTTCTTTGGGG  
    1820   1843  -       GCCCCGGAACTTGATCATGTGGG  
    2090   2113  -       GAAGTTGCTCTTGAAGTTGGGGG  
    2183   2206  -       GGCGTACTGGTCGCCGATCTGGG  
    2288   2311  -       GATCATAGAGGCGCTCAGGGGGG  
    2689   2712  -       GCCAGAGGGCCCACGTAGTAGGG  
    ︙
    

    Example code 8: Search for a DNA sequence motif with fuzzy matching

    Search for "AAAAAAAA" sequence, permitting a single nucleotide mismatch.
    (Expected runtime: less than 1 sec.)

    Source code (continued from the previous code)

    match_list = plasmid.searchsequence(query="(?:AAAAAAAA){s<=1}")
    plasmid.printfeature(match_list, seq=True) 
    

    Output

    feature_id  feature_type  qualifiers:label  start  end   strand  sequence  
    null        misc_feature  null              5484   5492  +       AAAAAAGA  
    null        misc_feature  null              6369   6377  +       AACAAAAA  
    null        misc_feature  null              7872   7880  +       AAACAAAA  
    null        misc_feature  null              346    354   -       AAAACAAA  
    null        misc_feature  null              799    807   -       AAAAAATA  
    null        misc_feature  null              1201   1209  -       GAAAAAAA  
    null        misc_feature  null              6716   6724  -       AAAAATAA  
    null        misc_feature  null              7844   7852  -       AGAAAAAA 
    

    Example code 9: Search for a DNA sequence with the IUPAC nucleotide code

    (Expected runtime: less than 1 sec.)

    Source code (continued from the previous code)

    match_list = plasmid.searchsequence(query="SWSWSWDSDSBHBRHH")
    plasmid.printfeature(match_list, seq=True)
    

    Output

    feature_id  feature_type  qualifiers:label  start  end   strand  sequence          
    null        misc_feature  null              4098   4114  +       GAGACAGCTGGTGGAA  
    null        misc_feature  null              3550   3566  -       CTGTCTGCAGGATGCC  
    null        misc_feature  null              5239   5255  -       CTCTGATGGGCTTATC  
    null        misc_feature  null              6415   6431  -       GAGAGTGCACCATAAA  
    null        misc_feature  null              8357   8373  -       GTCAGAGGTGGCGAAA  
    
  • .searchfeature(key_attribute=str, query=regex or str, source=list of DNAfeature_objects, start=int, end=int, strand=int, product=str, process_name=str, process_description="str")

    Search for DNAfeature_objects holding a queried value in a designated key_attribute in QUEEN_object.

    Parameters

    • key_attribute: str (default: "all")
      Attribute type to be searched (feature_id, feature_type, "qualifiers:*", or sequence). If the value is not provided, it will be applied to all of the attributes in the QUEEN_object, excluding sequence. However, if the query value is provided with only the four nucleotide letters (A, T, G, and C), this value will be automatically set to sequence.
    • query: regex or str(default: ".+")
      Query term. DNAfeature_objects that have a value matches to this query for key_attribute designated above will be returned. It allows fuzzy matching and regular expression. For details, see https://pypi.org/project/regex/. If the key_attribute is sequence, all IUPAC nucleotide symbols can be used.
    • source: list of_ DNAfeature_objects (default: QUEEN_object.dnafeatures)
      Source DNAfeature_objects to be searched. DNAfeature_objects outside the search range defined by start, end, and strand will be removed from the source. Any DNAfeature_objects can be provided here. For example, a list of DNAfeature_objects _returned from another searchsequence() or searchfeature() operation can be used as the source to achieve an AND search with multiple queries.
    • start: int (zero-based indexing; default: 0)
      Start position of the target range of the QUEEN_object sequence for the search.
    • end: int (zero-based indexing; default: the last sequence position of QUEEN_object)
      End position of the target range of the QUEEN_object sequence for the search.
    • strand: int: 1 (top strand only), -1 (bottom strand only), or 2 (both strands) (default: 2)
      Sequence strand to be searched.

    Return

    list (list of DNAfeature_objects)

    Example code 10: Search for sequence features having specific attribute values

    Search for DNAfeature_objects with a feature type "primer_bind", and then further screen ones holding a specific string in "qualifiers:label".
    (Expected runtime: less than 1 sec.)

    Source code (continued from the previous code)

    feature_list = plasmid.searchfeature(key_attribute="feature_type", query="primer_bind")
    plasmid.printfeature(feature_list)
    sub_feature_list = plasmid.searchfeature(key_attribute="qualifier:label", query=".+-R$", source=feature_list)
    plasmid.printfeature(sub_feature_list)
    

    Output

    feature_id  feature_type  qualifiers:label  start  end   strand  
    200         primer_bind   hU6-F            0      21    +       
    300         primer_bind   LKO.1 5'         171    191   +       
    1200        primer_bind   BGH-rev          5524   5542  -       
    1700        primer_bind   F1ori-R          6048   6068  -       
    1800        primer_bind   F1ori-F          6258   6280  +       
    1900        primer_bind   pRS-marker       6433   6453  -       
    2000        primer_bind   pGEX 3'          6552   6575  +       
    2100        primer_bind   pBRforEco        6612   6631  -       
    2400        primer_bind   Amp-R            7021   7041  -       
    2600        primer_bind   pBR322ori-F      8323   8343  +       
    
    feature_id  feature_type  qualifiers:label  start  end   strand  
    1700        primer_bind   F1ori-R          6048   6068  -       
    2400        primer_bind   Amp-R            7021   7041  -   
    

Operational functions

QUEEN objects can be manipulated by four simple operational functions, cutdna(), modifyends(), flipdna(), and joindna(), that can collectively represent any of the standard molecular DNA cloning processes, and two super functions, editsequence() and editfeature().

  • cutdna(input=QUEEN_object, *cutsites=*list of (int, "int/int", or DNAfeature_object), product=str, process_name=str, process_discription="str")

    Cut QUEEN_object at queried positions or by queried DNAfeature_object and return a list of fragmented QUEEN_object. Each existing DNAfeature_object in the original QUEEN_object will be inherited to the generating QUEEN_object. Suppose any DNAfeature_objects are at the cut boundaries being split into fragments. In that case, each DNAfeature_object will also be carried over to the new QUEEN_object with the "qualifiers:broken_feature" attribute to be "[.project of the original QUEEN_object]:[.feature_id of the original DNAfeature_object]:[sequence length of the original DNAfeature_object]:[sequence of the original DNAfeature_object]:[start..end positions of the original DNAfeature_object in the sequence of the original QUEEN_object]:[5'..3' end positions of the broken DNAfeature_object in the original DNAfeature_object]". This function also linearizes a circular QUEEN_object.

    Parameters

    • input: QUEEN_object
    • cutsites: list of int, "int/int", and/or DNAfeature_objects
      List of cut positions. For blunt-end cut, a cut position can be provided by int. For sticky-end cut, a cut position can be specified by "int/int", where the left and right integers represent cut positions on the top and bottom strands, respectively. DNAfeature_objects holding "qualifiers:cut_site" attributes can also be provided to cut a query DNA. This operation cannot proceed with multiple cut sites where a nicking or blunt-end cut of a cutting event happens between two nick positions of another sticky-end cut.

    Valid case: cutdna(object, *["100/105", "120/110", "50/55"])
    Invalid case: cutdna(object, *["50/105", "100/55", "120/110"])

    Return

    list (list of QUEEN_objects)

    Example code 11: Cut pX330 plasmid at multiple positions

    Cut a circular plasmid px330 at the three different positions, resulting in the generation of three fragments. Then, cut one of the three fragments again.
    (Expected runtime: less than 1 sec.)

    Source code (continued from the previous code)

    print(plasmid)
    fragments = cutdna(plasmid ,1000, 2000, 4000)
    print(fragments)
    fragment3, fragment4 = cutdna(fragments[1], 500)
    print(fragment3)
    print(fragment4)
    

    Output

    <queen.QUEEN object; project='pX330', length='1000 bp', topology='linear' >, <queen.QUEEN object; project='pX330', length='2000 bp', topology='linear' >, <queen.QUEEN object; project='pX330', length='5484 bp', topology='linear' >]
    <queen.QUEEN object; project='pX330', length='500 bp', topology='linear' >
    <queen.QUEEN object; project='pX330', length='1500 bp', topology='linear' >
    

    If an invalid cut pattern are provided, an error message will be returned.

    Source code (continued from the previous code)

    fragments = cutdna(plasmid, *["50/105", "100/55", "120/110"])
    

    Error message

    ValueError: Invalid cut pattern.
    

    Example code 12: Digest pX330 plasmid by EcoRI

    Digestion of pX330 plasmid with EcoRI can be simulated as follows.

    1. Search for EcoRI recognition sites in pX330 with its cut motif and obtain the DNAfeature_objects representing its cut position(s) and motif.
    2. Use the DNAfeature_objects to cut pX330 by cutdna().

    (Expected runtime: less than 1 sec.)

    Source code (continued from the previous code)

    sites     = plasmid.searchsequence("G^AATT_C")
    fragments = cutdna(plasmid, *sites)
    for fragment in fragments:
        print(fragment)
        fragment.printsequence(display=True, hide_middle=10)
    

    Output

    <queen.QUEEN object; project='pX330', length='8488 bp', topology='linear' >
    5' AATTCCTAGA...AGTAAG---- 3'
    3' ----GGATCT...TCATTCTTAA 5'
    

    QUEEN provides a library of restriction enzyme motifs (described in the New England Biolab's website).

    Source code (continued from the previous code)

    from QUEEN import cutsite #Import a restriction enzyme library
    sites = plasmid.searchsequence(cutsite.lib["EcoRI"])
    fragments = cutdna(plasmid, *sites)
    for fragment in fragments:
        print(fragment)
        fragment.printsequence(display=True, hide_middle=10) 
    

    Output

    <queen.QUEEN object; project='pX330', length='8488 bp', topology='linear' >
    5' AATTCCTAGA...AGTAAG---- 3'
    3' ----GGATCT...TCATTCTTAA 5'
    

    Example code 13: Digest pX330 plasmid by Type-IIS restriction enzyme BbsI

    (Expected runtime: less than 1 sec.)

    Source code (continued from the previous code)

    sites = plasmid.searchsequence("GAAGAC(2/6)")
    fragments = cutdna(plasmid,*sites)
    for fragment in fragments:
        print(fragment)
        fragment.printsequence(display=True, hide_middle=10)
    

    Output

    <queen.QUEEN object; project='pX330', length='8466 bp', topology='linear' >
    5' GTTTTAGAGC...ACGAAA---- 3'
    3' ----ATCTCG...TGCTTTGTGG 5'
    
    <queen.QUEEN object; project='pX330', length='26 bp', sequence='CACCGGGTCTTCGAGAAGACCTGTTT', topology='linear'>
    5' CACCGGGTCT...AGACCT---- 3'
    3' ----CCCAGA...TCTGGACAAA 5'
    

    Here, the BbsI recognition motif can also be represented by "(6/2)GTCTTC", "GAAGACNN^NNNN_" or "^NNNN_NNGTCTTC". The BbsI recognition motif is also available from the library of restriction enzyme motifs.

    Source code (continued from the previous code)

    from QUEEN import cutsite #Import a restriction enzyme library 
    sites = plasmid.searchsequence(cutsite.lib["BbsI"])
    fragments = cutdna(plasmid, *sites)
    for fragment in fragments:
        print(fragment)
        fragment.printsequence(display=True, hide_middle=10) 
    

    Output

    <queen.QUEEN object; project='pX330', length='8466 bp', topology='linear' >
    5' GTTTTAGAGC...ACGAAA---- 3'
    3' ----ATCTCG...TGCTTTGTGG 5'
     
    <queen.QUEEN object; project='pX330', length='26 bp', sequence='CACCGGGTCTTCGAGAAGACCTGTTT', topology='linear'>
    5' CACCGGGTCT...AGACCT---- 3'
    3' ----CCCAGA...TCTGGACAAA 5'
    
  • cropdna(input=QUEEN_object, start=int, "int/int", or DNAfeature_object, end=int, "int/int", or DNAfeature_object, product=str, process_name=str, process_description="str")

    This is a subfunction of cutdna() and extracts a partial fragment from QUEEN_object.

    Parameters

    • input: QUEEN_object
    • start: int, "int/int" (zero-based indexing) or DNAfeature_object (default: 0)
      Start position of the fragment of the QUEEN_object sequence to be trimmed.
    • end: int, "int/int" (zero-based indexing)or DNAfeature_object (default: the last sequence position of QUEEN_object)
      End position of the fragment of the QUEEN_object sequence to be trimmed. If the topology of the QUEEN_object is "linear", the end position must be larger than the start position. If the topology is "circular" and the start position is larger than the end position, the fragment across the zero position will be returned.

    Return

    QUEEN_object

    Example code 14: Crop a sequence fragment within a specified region

    If the second fragment of "Example code 11" is for further manipulation, cropdna() is convenient.
    (Expected runtime: less than 1 sec.)

    Source code (continued from the previous code)

    fragment = cropdna(plasmid ,2000, 4000)
    print(fragment)
    

    Output

    <queen.QUEEN object; project='pX330', length='2000 bp', topology='linear' >
    

    If a start position is larger than an end position, an error message will be returned.

    Source code (continued from the previous code)

    fragment = cropdna(fragment, 1500, 1000)
    

    Error message

    ValueError: 'end' position must be larger than 'start' position.
    
  • modifyends(input=QUEEN_object, left="str/str", right="str/str", product=str, process_name=str, process_description="str")

    Modify sequence end structures of QUEEN_object. If the topology is "circular", it won't work.

    Parameters

    • input: QUEEN_object
    • left: "str", "str/str" (default: None)
      Left sequence end structure of QUEEN_object. The following examples show how to provide this parameter.
    • right: "str", "str/str" (default: None)
      Right sequence end structure of QUEEN_object. The following examples show how to describe the parameter.

    Return

    QUEEN_object

    Example code 15: Trim nucleotides from a blunt-ended dsDNA to generate a sticky-ended dsDNA

    Sticky ends can be generated by trimming nucleotides where their end structures are given by top and bottom strand strings with "*" and "-" separated by "/", respectively. The letters "-" indicate nucleotide letters to be trimmed, and the letters "*" indicate ones to remain.
    (Expected runtime: less than 1 sec.)

    Source code (continued from the previous code)

    fragment = cropdna(plasmid, 100, 120)
    fragment.printsequence(display=True)
    fragment = modifyends(fragment, "-----/*****", "**/--")
    fragment.printsequence(display=True)
    

    Output

    5' CTTAACGTTGGCTTGCCACG 3'
    3' GAATTGCAACCGAACGGTGC 5'
    
    5' ----ACGTTGGCTTGCCACG 3'
    3' GAATTGCAACCGAACGGT-- 5'
    

    The following codes achieve the same manipulation.
    Source code (continued from the previous code)

    fragment = cropdna(plasmid,'105/100', '120/118')
    fragment.printsequence(display=True)
    

    A regex-like format can also be used.
    Source code (continued from the previous code)

    fragment = modifyends(fragment, "-{5}/*{5}","*{2}/-{2}")
    fragment.printsequence(display=True)
    

    If a QUEEN object with circular topology is given, an error message will be returned.
    Source code (continued from the previous code)

    fragment = modifyends(plasmid, "-----/*****", "**/--")
    

    Error message

    ValueError: End sequence structures cannot be modified. The topology of the QUEEN_object is circular.
    

    Example code 16: Add adapter sequences

    modifyends() can also add adapter sequences to DNA ends.
    (Expected runtime: less than 1 sec.)

    Source code (continued from the previous code)

    #Add blunt-ended dsDNA sequences to both ends
    fragment = cropdna(plasmid, 100, 120)
    fragment = modifyends(fragment,"TACATGC","TACGATG")
    fragment.printsequence(display=True)
    #Add sticky-ended dsDNA sequences to both ends
    fragment = cropdna(plasmid, 100, 120)
    fragment = modifyends(fragment,"---ATGC/ATGTACG","TACG---/ATGCTAC")
    fragment.printsequence(display=True)
    

    Output

    5' TACATGCTACAAAATACGTGACGTAGATACGATG 3'
    3' ATGTACGATGTTTTATGCACTGCATCTATGCTAC 5'
    
    5' ---ATGCTACAAAATACGTGACGTAGATACG--- 3'
    3' ATGTACGATGTTTTATGCACTGCATCTATGCTAC 5'
    
  • flipdna(input=QUEEN_object, product=str, process_name=str, process_description="str")

    Invert QUEEN_object.

    Parameters

    • input: QUEEN_object

    Return

    QUEEN_object

  • joindna(*inputs=*list of QUEEN objects, topology=str, product=str, process_name=str, process_description="str")

    Assemble QUEEN_object. The connecting DNA end structures must be compatible (i.e., only blunt ends and compatible sticky ends can be assembled). If the assembly restores unfragmented sequences of DNAfeature_objects that are fragmented before the assembly and hold "qualifiers:broken_feature" attributes, the original DNAfeature_objects will be restored in the output QUEEN_object (the fragmented DNAfeature_objects will not be inherited). A single linear QUEEN_object processed by this function will be circularized.

    Parameters

    • inputs: list of QUEEN_object
    • topology: str ("linear" or "circular"; default: "linear")
      Topology of the output QUEEN_object.

    Return

    QUEEN_object

    Example code 17: Clone an EGFP fragment into pX330

    1. Generate a QUEEN class object for an EGFP fragment,
    2. Create EcoRI sites to both ends of the EGFP fragment,
    3. Digest the EGFP fragment and pX330 by EcoRI, and
    4. Assemble the EGFP fragment and linearized pX330.  

    (Expected runtime: less than 1 sec.)

    Source code (continued from the previous code)

    EGFP     = QUEEN(record="input/EGFP.fasta")
    EGFP     = modifyends(EGFP, cutsite.lib["EcoRI"].seq, cutsite.lib["EcoRI"].seq)
    sites    = EGFP.searchsequence(cutsite.lib["EcoRI"]) 
    insert   = cutdna(EGFP, *sites)[1]
    insert.printsequence(display=True, hide_middle=10)
    sites    = plasmid.searchsequence(cutsite.lib["EcoRI"])
    backbone = cutdna(plasmid, *sites)[0]
    backbone.printsequence(display=True, hide_middle=10)
    pEGFP    = joindna(backbone, insert, topology="circular") 
    print(plasmid)
    print(EGFP)
    print(pEGFP) 
    

    Output

    5′ AATTCGGCAG...ACAAGG---- 3′
    3′ ----GCCGTC...TGTTCCTTAA 5′
    
    5′ AATTCCTAGA...AGTAAG---- 3′
    3′ ----GGATCT...TCATTCTTAA 5′
     
    <queen.QUEEN object; project='pX330', length='8484 bp', topology='circular'>
    <queen.QUEEN object; project='EGFP', length='789 bp', topology='linear'>
    <queen.QUEEN object; project='pX330', length='9267 bp', topology='circular'>
    

    If connecting DNA end structures of the input QUEEN_object are not compatible, an error message will be returned.
    Source code (continued from the previous code

    EGFP     = QUEEN(record="input/EGFP.fasta")
    EGFP     = modifyends(EGFP, cutsite.lib["BamHI"].seq, cutsite.lib["BamHI"].seq)
    sites    = EGFP.searchsequence(cutsite.lib["BamHI"]) 
    insert   = cutdna(EGFP, *sites)[1]
    insert.printsequence(display=True, hide_middle=10)/
    pEGFP    = joindna(backbone, insert, topology="circular") 
    

    Error message

    ValueError: The QUEEN_objects cannot be joined due to the end structure incompatibility.
    

    Example code 18: Create a gRNA expression plasmid

    pX330 serves as a standard gRNA expression backbone plasmid. A gRNA spacer can simply be cloned into a BbsI-digested destination site of pX330 as follows:

    1. Generate QUEEN object for a sticky-ended gRNA spacer dsDNA,
    2. Digest pX330 by BbsI, and
    3. Assemble the spacer with the BbsI-digested pX330.  

    (Expected runtime: less than 1 sec.)

    Source code (continued from the previous code)

    gRNA      = QUEEN(seq="CACCGACCATTGTTCAATATCGTCC----/----CTGGTAACAAGTTATAGCAGGCAAA") 
    sites     = plasmid.searchsequence(cutsite.lib["BbsI"])
    fragments = cutdna(plasmid, *sites)
    backbone  = fragments[0] if len(fragments[0].seq) > len(fragments[1].seq) else fragment[1]
    pgRNA     = joindna(gRNA, backbone, topology="circular")
    print(backbone)
    print(insert)
    print(pgRNA) 
    

    Output

    <queen.QUEEN object; project='pX330_26', length='8466 bp', topology='linear'>
    <queen.QUEEN object; project='EGFP_2', length='787 bp', topology='linear'>
    <queen.QUEEN object; project='pgRNA', length='8487 bp', topology='circular'>
    

    Example code 19: Flip ampicillin-resistant gene in pX330

    1. Search for the ampicillin-resistant gene in pX330,
    2. Cut pX330 with start and end positions of the ampicillin-resistant gene,
    3. Flip the ampicillin-resistant gene fragment, and
    4. Join it with the other fragment.  

    (Expected runtime: less than 1 sec.)

    Source code (continued from the previous code)

    site         = plasmid.searchfeature(query="^AmpR$")[0]
    fragments    = cutdna(plasmid, site.start, site.end)
    fragments[0] = flipdna(fragments[0])
    new_plasmid  = joindna(*fragments, topology="circular")
    plasmid.printfeature(plasmid.searchfeature(query="^AmpR$"))
    new_plasmid.printfeature(new_plasmid.searchfeature(query="^AmpR$"))  
    

    Output

    feature_id  feature_type  qualifiers:label  start  end   strand  
    2300        CDS           AmpR              6803   7664  +       
    
    feature_id  feature_type  qualifiers:label  start  end   strand  
    2400        CDS           AmpR              6803   7664  -  
    
  • editsequence(input=QUEEN object, source_sequence=regex or str, destination_sequence=str, start=int, end=int, strand=int, product=str, process_name=str, process_description="str")

    Edit sequence of QUEEN_object by searching target sequence fragments matched to a source_sequence and replacing each of them with a destination_sequence. All DNAfeature_objects located on the edited sequence regions will be given the "qualifiers:broken-feature" attribute. In any sequence edit that confers change in the sequence length of the QUEEN object, the coordinates of all affected DNAfeature_objects will be adjusted. This is the parental function of searchsequence(). If destination_sequence is not provided, it works just as searchsequence().

    Parameters

    • input: QUEEN object
    • source_sequence: regex or str (default: ".+")
      Source sequence(s) to be replaced. If the value is not provided, the entire QUEEN_object sequence will be replaced with a destination_sequence. It allows fuzzy matching and regular expression. For details, see https://pypi.org/project/regex/. All IUPAC nucleotide symbols can also be used. Substrings of the regex value can be isolated by enclosing them in parentheses. Each pair of parentheses is indexed sequentially by numbers from left to right. Isolated substrings can be replaced at once by providing a destination_sequence where each substring replacement is designated, referring to the index numbers. For details, see https://docs.python.org/3/library/re.html#re.sub
    • destination_sequence: str (default: None)
      Destination sequence.
    • start:int (zero-based indexing; default: 0)
      Start position of the target range of the QUEEN_object sequence to be searched for the replacement.
    • end:int (zero-based indexing; default: the last sequence position of QUEEN_object)
      End position of the target range of the QUEEN_object sequence to be searched for the replacement.
    • strand: int: 1 (top strand only), -1 (bottom strand only), or 2 (both strands) (default: 2)
      Sequence strand to be searched for the replacement.

    Return

    If destination_sequence is not provided, it will act as searchsequence() and return a list of DNAFeature_objects. Otherwise, QUEEN_object .

    Example code 20: Insert an EGFP sequence into pX330

    An EGFP sequence insertion to the EcoRI site demonstrated in Example code17 can be described with a simpler code using editsequence().
    (Expected runtime: less than 1 sec.)

    Source code (continued from the previous code)

    EGFP  = QUEEN(record="input/EGFP.fasta")
    pEGFP = editsequence(plasmid, "({})".format(cutsite.lib["EcoRI"].seq), r"\1{}\1".format(EGFP.seq))
    print(plasmid)
    print(pEGFP)
    

    Output

    <queen.QUEEN object; project='pX330', length='8484 bp', topology='circular'>
    <queen.QUEEN object; project='pX330', length='9267 bp', topology='linear'>
    
  • editfeature(input=QUEEN_object, key_attribute=str, query=regex or str, source=list of DNAfeature_objects, start=int, end=int, strand=int, target_attribute=str, operation=function, quine=bool, new_copy=bool, product=str, process_name=str, process_description="str")

    Search for DNAfeature_objects holding a query value in a designated key_attribute and edit a target_attribute of the same DNAfeature_objects with one of the three operations: removeattribute, replaceattribute, or createattribute. This is the parental function of searchfeature(). If target_attribute is not provided, it works just as searchfeature().

    Parameters

    • input: QUEEN object
    • key_attribute: str (default: "all")
      Attribute type to be searched (feature_id, feature_type, "qualifiers:*", or sequence). If the value is not provided, it will be applied to all of the attributes in the QUEEN_object, excluding sequence. However, if the query value is provided with only the four nucleotide letters (A, T, G, and C), this value will be automatically set to sequence.
    • query: regex or str (default: ".+")
      Query term. DNAfeature_objects that have a value matches to the query value for key_attribute designated above will be subjected to the edit. It allows fuzzy matching and regular expression. For details, see https://pypi.org/project/regex/. If the key_attribute is sequence, all IUPAC nucleotide symbols can be used.
    • source:list of DNAfeature_objects (default: QUEEN_object.dnafeatures)
      Source DNAfeature_objects to be searched for the editing. DNAfeature_objects outside the search range defined by start, end, and strand will be removed from the source. Any DNAfeature_objects can be provided here. For example, a list of DNAfeature_objectsreturned from searchsequence() or searchfeature() operation can be used as the source.
    • start:int (zero-based indexing; default: 0)
      Start position of the target range of the QUEEN_object sequence for the editing.
    • end:int (zero-based indexing; default: the last sequence position of QUEEN_object)
      End position of the target range of the QUEEN_object sequence for the editing.
    • strand: int: 1 (top strand only), -1 (bottom strand only), or 2 (both strands) (default: 2)
      Sequence strand to be searched.
    • target_attribute: str (default:None)
      Attribute type of the target DNAfeature_objects to be edited (feature_id, feature_type, "qualifiers:*", strand, start, end or sequence). If the value is not provided, this will work just as searchfeature().
    • operation: removeattribute(), createattribute(value="str") or replaceattribute(source_value=regex or str, destination_value=str or int) (default: None)
      If the operation is not specified, this will work just as searchfeature().
      • removeattribute(): This removes target_attribute from the target DNAfeature_objects but only for feature_id or "qualifiers:*". If target_attribute is feature_id, the entire DNAfeature_objects will be erased from the QUEEN_object.
      • createattribute(value="str"): This creates or overwrites target_attributes of the targetDNAfeature_objects with "str". If target_attribute is feature_id and there is no existing DNAfeature_object with the same feature_id of "str", it will create the new DNAfeature_object in the QUEEN_object.dnafeatures. If the search by DNAfeature_objects determines multiple DNAfeature_objects to be created, each feature_id of the new DNAfeature_objects is generated as "str-number", where numbers follow the order they were searched. If the same feature_id of "str" already exists in the operating QUEEN_object.dnafeatures, the DNAfeature_object will be generated with the feature_id="str-number". If target_attribute is "qualifiers:*", the qualifier whose value is "str" will be added into the .qualifiers of the target DNAfeature_object as long as it does not overlap with the existing .qualifiers.
      • replaceattribute(source_value=regex or str, destination_value=str or int): This will search for substrings in values of the target_attributes of the target DNAfeature_object that match to the source_value and replace them with the destination_value. Similar to editsequence(), substrings of the regex value can be isolated by enclosing them in parentheses. Each pair of parentheses is indexed sequentially by numbers from left to right. Isolated substrings can be replaced at once by providing a destination_sequence where each substring replacement is designated, referring to the index numbers. For details, see https://docs.python.org/3/library/re.html#re.sub. If the target_attribute is sequence, the sequences corresponding to the target DNAfeature_object can be modified like editsequence(). When the source_value is not provided, the entire data value will be replaced with the destination value. If the target_attribute is feature_id, the replacement will be operated only when no conflict with the existing DNAfeature_object. If target_attribute is start, end, or strand, no source_value is required, and the destination_value must be int.
    • quine:bool (True or False; default: True if target_attribute is "sequence". Otherwise, False)
      If False, the operation process will not be recorded into the building history.
    • new_copy:bool (default: True) If True, it will first generate a copy of the QUEEN_object and edit it. Otherwise, the original QUEEN_object will be edited directly (Note that this mode does not record the operation process into the building history).

    Return

    If operation or target_attribute is not specified, it will act as searchfeature() and return a list of DNAFeature_objects
    If new_copy is True, QUEEN_object, otherwise None.

    Example code 21: Insert a DNA string "AAAAA" to the 5’ end of every CDS

    (Expected runtime: less than 1 sec.)

    Source code (continued from the previous code)

    new_plasmid = editfeature(plasmid, key_attribute="feature_type", query="CDS", 
                               strand=1, target_attribute="sequence", operation=replaceattribute(r"(.+)", r"AAAAA\1"))
    for feat in new_plasmid.searchfeature(key_attribute="feature_type", query="CDS", strand=1):
        print(feat.start, feat.end, new_plasmid.printsequence(feat.start, feat.start+20, strand=1), feat.qualifiers["label"][0], sep="\t")
    

    Output

    1231	1302	AAAAAGACTATAAGGACCAC	3xFLAG
    1308	1334	AAAAACCAAAGAAGAAGCGG	SV40 NLS
    1358	5464	AAAAAGACAAGAAGTACAGC	Cas9
    5464	5517	AAAAAAAAAGGCCGGCGGCC	nucleoplasmin NLS
    6823	7689	AAAAAATGAGTATTCAACAT	AmpR
    

    Example code 22: Convert the feature type of every annotation from "CDS" to "gene"

    (Expected runtime: less than 1 sec.)

    Source code (continued from the previous code)

    new_plasmid = editfeature(plasmid, key_attribute="feature_type", query="CDS", 
    target_attribute="feature_type", operation=replaceattribute("gene"))
    new_plasmid.printfeature()
    

    Output

    feature_id  feature_type   qualifier:label     start  end   strand  
    1           source         null                0      8484  +       
    100         promoter       U6 promoter         0      241   +       
    200         primer_bind    hU6-F               0      21    +       
    300         primer_bind    LKO.1 5'            171    191   +       
    400         misc_RNA       gRNA scaffold       267    343   +       
    500         enhancer       CMV enhancer        439    725   +       
    600         intron         hybrid intron       983    1211  +       
    700         regulatory     null                1222   1232  +       
    800         gene           3xFLAG              1231   1297  +       
    900         gene           SV40 NLS            1303   1324  +       
    1000        gene           Cas9                1348   5449  +       
    1100        gene           nucleoplasmin NLS   5449   5497  +       
    1200        primer_bind    BGH-rev             5524   5542  -       
    1300        polyA_signal   bGH poly(A) signal  5530   5738  +       
    1400        repeat_region  AAV2 ITR            5746   5887  +       
    1500        repeat_region  AAV2 ITR            5746   5876  +      
    1600        rep_origin     f1 ori              5961   6417  +       
    1700        primer_bind    F1ori-R             6048   6068  -       
    1800        primer_bind    F1ori-F             6258   6280  +       
    1900        primer_bind    pRS-marker          6433   6453  -       
    2000        primer_bind    pGEX 3'             6552   6575  +       
    2100        primer_bind    pBRforEco           6612   6631  -       
    2200        promoter       AmpR promoter       6698   6803  +       
    2300        gene           AmpR                6803   7664  +       
    2400        primer_bind    Amp-R               7021   7041  -       
    2500        rep_origin     ori                 7834   8423  +       
    2600        primer_bind    pBR322ori-F         8323   8343  +     
    

    Example code 23: Add single cutter annotations to pX330

    1. Search for all of the single restriction enzyme cutters in pX330 using the library of restriction enzymes listed on the website of NEW England Biolabs.
    2. Add the single cutter annotations to pX330.

    (Expected runtime: less than 1 sec.)

    Source code (continued from the previous code)

    unique_cutters = []
    for key, re in cutsite.lib.items():
        sites = plasmid.searchsequence(re.cutsite)
        if len(sites) == 1: 
            unique_cutters.append(sites[0])
        else:
            pass
    new_plasmid = editfeature(plasmid, source=unique_cutters, target_attribute="feature_id", operation=createattribute("RE"))
    new_plasmid = editfeature(new_plasmid, key_attribute="feature_id", query="RE", target_attribute="feature_type", operation=replaceattribute("misc_bind"))
    features    = new_plasmid.searchfeature(key_attribute="feature_type", query="misc_bind")
    new_plasmid.printfeature(features, seq=True)
    

    Output

    RE-1        misc_bind     Acc65I           433    439   +       GGTACC        
    RE-2        misc_bind     AgeI             1216   1222  +       ACCGGT        
    RE-3        misc_bind     ApaI             2700   2706  +       GGGCCC        
    RE-4        misc_bind     BglII            1595   1601  +       AGATCT        
    RE-5        misc_bind     BsaBI            4839   4849  +       GATCACCATC    
    RE-6        misc_bind     BseRI            1098   1104  -       GAGGAG        
    RE-7        misc_bind     BsmI             4979   4985  +       GAATGC        
    RE-8        misc_bind     CspCI            4127   4139  +       CAAAGCACGTGG  
    RE-9        misc_bind     EcoRI            5500   5506  +       GAATTC        
    RE-10       misc_bind     EcoRV            3196   3202  +       GATATC        
    RE-11       misc_bind     FseI             5472   5480  +       GGCCGGCC      
    RE-12       misc_bind     FspI             7365   7371  +       TGCGCA        
    RE-13       misc_bind     KasI             5887   5893  +       GGCGCC        
    RE-16       misc_bind     NotI             5738   5746  +       GCGGCCGC      
    RE-17       misc_bind     PaqCI            1184   1191  +       CACCTGC       
    RE-19       misc_bind     PmlI             4132   4138  +       CACGTG        
    RE-20       misc_bind     PsiI             6317   6323  +       TTATAA        
    RE-22       misc_bind     PvuI             7218   7224  +       CGATCG        
    RE-23       misc_bind     SacII            7522   7528  +       CCGCGG        
    RE-24       misc_bind     SbfI             5879   5887  +       CCTGCAGG      
    RE-26       misc_bind     SnaBI            698    704   +       TACGTA        
    RE-27       misc_bind     XbaI             427    433   +       TCTAGA
    

Common parameters of the quinable functions

DNA construction process achieved by the search functions searchsequence() and searchfeature(), operational functions cutdna(), cropdna(), modifyends(), flipdna(), and joindna() and super functions editsequence() and editfeature() described up to here can progressively be recorded into the manipulating QUEEN object, which enables to generate a quine code that replicates the same QUEEN object by the quine() function described below. From here, we call these functions "quinable" functions.

In addition to the parameters and options described above for the quinable functions, all of them can commonly take the three parameters, process_name, process_description, and product, that enable annotation and structured visualization of the construction process (see below). These optional parameters do not affect the behavior of the quinable functions.

  • process_name (or pn):str (default: "") This option enables users to provide label names for process flow groups. An experimental flow composed of sequential operations by quinable functions can be grouped and labeled with a user-defined name by providing the same name to the quinable function operations belonging to the same target group. Such group labels can be, for example, "PCR 1", "EcoRI digestion", "Gibson Assembly", etc. visualizeflow() described below takes into account the group information to generate experimental flow maps from QUEEN_objects.

  • process_description (or pd): str (default: "") Similar to process_name, this option enables users to provide narrative descriptions of operations conferred by quinable functions. This enables the generation of the whole "Materials and Methods" description for a DNA construction process along with its DNA construction flow from a QUEEN_object (or a QUEEN-generated GenBank file) using the quine() function described below.

  • product: str (default: "") This option enables users to provide label names for producing QUEEN_objects. The provided labels are stored in QUEEN_objects.project.

Quine

quine (input=QUEEN_object, output=str, process_description=bool, execution=bool)

Generate "quine code" of QUEEN_object that produces the same QUEEN_object. A quine code can be executed as a Python script.

Parameters

  • input: QUEEN_object

  • output: str (default: STDOUT)
    Output file name.

  • process_description: bool (default: False)
    If True, this will output the process_descriptions registered to quinable operations along with the process flows. The output can be used for the "Material and methods" of the QUEEN_object construction process.

  • execution: bool (default: False)
    If True, this will reconstruct the QUEEN_object by generating and executing its quine code and confirm if the reconstructed QUEEN_object is identical to the original one. If execution is True and output is None, the quine code will be output into a temporary file instead of STDOUT; the temporary file will be removed after the operation. The execution won't happen if process_description is True.

Return

if execution is False, None. If execution is True, True if the reconstructed QUEEN_object is identical to the original one. Otherwise, False.

Example code 24: Obtain the quine code reconstructed pCMV-Target-AID

The Target-AID plasmid (pCMV-Target-AID) was constructed by assembling two fragments encoding the N- and C-terminus halves of Target-AID, which were both amplified from pcDNA3.1_pCMV-nCas-PmCDA1-ugi pH1-gRNA(HPRT) (Addgene 79620) using primer pairs RS045/HM129 and HM128/RS046, respectively, with a backbone fragment amplified from pCMV-ABE7.10 using RS047/RS048. The construction process was simulated by using quinable functions, and the GenBank file was generated. The quine code generated from the GenBank file by quine() successfully reconstructed the same GenBank file. The Python scripts for the following Example codes 24-27 can be found in "./demo/tutorial_ex24-28.ipynb".
(Expected runtime: less than 1 sec.)

Source code

from QUEEN.queen import *
(ommitted)
pCMV_Target_AID = QUEEN(record="./output/pCMV-Target-AID.gbk")
quine(pCMV_Target_AID, output="./output/pCMV-Target-AID_clone.py")

Shell commands

%python3 ./output/pCMV_Target_AID_clone.py > ./output/clone_pCMV-Target-AID.gbk
%diff -s ./output/pCMV_Target_AID.gbk ./output/clone_pCMV_Target_AID.gbk

Output

Files ./output/clone_pCMV-Target-AID.gbk and ./output/pCMV-Target-AID.gbk are identical.

Example code 25: Inheritance of operational histories

If a QUEEN_object is loaded from a QUEEN-generated GenBank file for a new DNA construction, the quine code of the original QUEEN_object will be inherited into the newly producing QUEEN_object. The following example demonstrates that a QUEEN_object representing a DNA fragment cropped from the QUEEN_object of pCMV-Target-AID holds not only the process history of the cropping but also the whole previous construction process of pCMV-Target-AID.
(Expected runtime: less than 1 sec.)

Source code (continued from the previous code)

description = "Extract a fragment spanning from 8,000 nt to 2,000 nt of pCMV-Target-AID"
cropdna(pCMV_Target_AID, 8000, 2000, product="fragment", process_description=description)
quine(fragment) 

Output (quine code generated from the "fragment" product)

︙(ommitted)
description5 = 'Extract a fragment spanning from 8,000 nt to 2,000 nt of pCMV-Target-AID'
cropdna(QUEEN.dna_dict['pCMV-BE4max_8'], start='8000/8000', end='2000/2000', project='pCMV-BE4max', product='fragment', process_description=description5)

There is an option import_history=False prepared for QUEEN() to disable the inheritance of operational process histories of previously generated QUEEN_objects to a newly producing QUEEN_object.

NOTE 1: Editing of quine code

quine() will provide each quinable process in a quine code with a unique process identifier in the process_id option, like "process_id=QUEEN_object.project–XXXXXXXXXXXXXXXXXXXXXXXX", where "Xs" represents md5() transformation of the quinable operation excluding the process_id and original_ids (described below). This process_id serves as a checksum to validate if any modification is provided to the operation code. Therefore, when a new QUEEN script is created by editing a quine code generated from an existing QUEEN_object or combining different process parts from multiple quine codes, the newly generating QUEEN_object will hold these previous process_ids. These process_ids will be passed over to a list original_ids of the corresponding new operation when a new quine code is generated from the new QUEEN_object. Hence, editing histories of quine codes and their inheritances can also be tracked and stored in QUEEN_objects.

NOTE 2: Recording of variable names

By default, QUEEN cannot track and record user-defined variable names of QUEEN_objects used in the original code. Therefore, the .project value of each QUEEN_object is used as its variable name when a quine code is generated. To generate a quine code with user-defined variable names for each operational step, the QUEEN_object needs to be generated with the Python command set_namespace(globals()) executed. This enables providing variable names of producing objects as arguments of their operational functions and, therefore, the recovery of variable names in quine codes.

For example, Example code 19 can be written in this format as follows.

Example code 26: Flip ampicillin-resistant gene in pX330 (variable embedding)

(Expected runtime: less than 1 sec.)

Original code

import sys 
from QUEEN.queen import * 
set_namespace(globals())
QUEEN(record="input/pX330.gbk", product="plasmid")
plasmid.searchfeature(query="^AmpR$", product="sites")
cutdna(plasmid, sites[0].start, sites[0].end, product="fragments")
flipdna(fragments[0], product="fragments0_rc")
joindna(fragments0_rc, fragments[1], topology="circular", product="new_plasmid")

Quine code

import sys
sys.path.append("/content/colab")
from QUEEN.queen import *
from QUEEN import cutsite as cs
set_namespace(globals())
QUEEN(record='input/pX330.gbk', product='plasmid', process_id='new_plasmid-9WZX2KEVGD9NVBR4DSWNBCSND320', original_ids=[])
plasmid.searchfeature(key_attribute='all', query='^AmpR$', product='sites', process_id='new_plasmid-52D5THPBJ8G961IHBTPEGI4JH321', original_ids=[])
cutdna(plasmid, sites[0].start, sites[0].end, product='fragments', process_id='new_plasmid-2XUXT7UUAIIY5UFUMC8TBPOHC322', original_ids=[])
flipdna(fragments[0], product='fragments0_rc', process_id='new_plasmid-30A7468VURMAE1DIOMS3A7JJP324', original_ids=[])
joindna(*[fragments0_rc, fragments[1]], topology='circular', product='new_plasmid', process_id='new_plasmid-649L08K2L92IMQ1SY8NDKX76B325', original_ids=[])

Visualization

QUEEN provides the following visualization functions.

  • visualizemap(input=QUEEN_object, map_view=str, feature_list=list, start=int, end=int, width_scale=float, height_scale=float, label_location=str, linebreak=int, seq=bool, diameter=float)

    Generate annotated sequence map of QUEEN_object with selected DNAfeature_objects. Each feature annotation label is retrieved from the "qualifier:label" attribute. All feature annotations and their label Locations of feature annotation labels are automatically adjusted to prevent overlaps on the sequence map. The face color and edge color of each feature annotation are also automatically assigned from the default colormap. However, they can be determined by "qualifiers:edgecolor_queen" and "qualifiers:facecolor_queen" attributes of DNAfeature_objects.

    Parameters

    • input: QUEEN_object
    • map_view: str ("linear" or "circular"; default: "linear")
      Visualization style.
    • feature_list: listof DNAfeaure_objects (default: QUEEN_object.dnafeatures excluding those with the feature type "source")
      DNAfeature_objects to be displayed on the sequence map.
    • fontsize: int (default: 12 for "circular" map and 10 for "linear" map)
      Common font size. Separate font sizes can also be defined for different DNAfeaure_objects by editing the "qualifiers:fontsize_queen" attribute, which overrides the common font size.
    • labelcolor: str(default: "black") Common font color for all feature labels. Separate font colors can also be defined for different DNAfeaure_objects by editing the "qualifiers:labelcolor_queen" attribute, which overrides the common font color.
    • display_label: 0, 1 or 2 (default: 2)
      If 2, all of the labels will be displayed. If 1, only the feature labels that can fit inside the object boxes will be displayed. If 0, feature labels won't be displayed.
    • tick_interval: int(default: None) Tick interval of sequence map (base pairs).\
    • display_axis: bool (default: True)
    • title: str (default: QUEEN_object.project)

    Parameters available for only linear maps

    • start: int (zero-based indexing; default: 0)
      Start position of the QUEEN_object sequence to be displayed.
    • end: int (zero-based indexing; default: the last sequence position of QUEEN_object)
      End position of the QUEEN_object sequence to be displayed.
    • width_scale: float(default: None)
      Scaling factor for the width of the sequence map.
    • height_scale: float(default: None)
      Scaling factor for the height of the sequence map.
    • label_location: str(default: "either" when seq is False, otherwise "top")
      Feature label locations. Each feature label is generally placed inside the object box. However, if a feature label is larger than the object box, the label will be put outside. If this value is "either", labels will be put below or above the object boxes, whichever is available. If this value is "top", labels will be put above the object boxes. If seq is True, the value must be set to "top".
    • linebreak: int or None (default: Length of the QUEEN_object sequence)
      Sequence length for line break.
    • seq: bool (default: False)
      When True, a color map representing the QUEEN_object sequence will be displayed below the sequence map.

    Parameters available for only circular maps

    • **diameter_scale ** Scaling factor for the diameter of the sequence map.

    Return

    matplolib.pyplot.figure object

    Example code 27: Visualization of pCMV-Target-AID  

    (Expected runtime: less than a few min.)

    Source code (continued from the example code 24)

    fig_a = visualizemap(fragment1, title="fragment-1")
    fig_b = visualizemap(fragment2, title="fragment-2")
    fig_c = visualizemap(fragment3, linebreak=120, seq=True, title="fragment-3")
    features = pCMV_Target_AID.searchfeature(key_attribute="feature_type", query="^(?!.*primer).*$")
    fig_d = visualizemap(pCMV_Target_AID, feature_list=features, map_view="circular", tick_interval=1000, title="pCMV-Target-AID")
    

    Output figures

  • visualizeflow(input=list of QUEEN_objects, search_function=bool, grouping=bool, process_classification=bool, intermediate_product=bool)

    Generate flow charts representing construction processes of QUEEN_objects with four different types of nodes: file shape, round, uncolored rectangle, and colored box nodes, representing input gbk files, QUEEN_objects, DNAfeature_objects, and quinable functions, respectively.

    Parameters

    • input: list of QUEEN_objects
    • search_function (or sf): bool (default: True)
      If True, the generating flow charts will display all quinable processes involved to produce the QUEEN_objects. Otherwise, operations by the search functions will be omitted in the visualization.
    • grouping: bool (default: True)
      If True, the operations that has a same process_name will be grouped by a parental box.
    • inherited_process (or ip) : bool (default: False)
      If True, the construction process of previous QUEEN_objects inherited in the present QUEEN_object construction will also be displayed.
    • process_description (or pd): bool (default: False)
      If True, both process_names and process_descriptiosn will be displayed on the top left of the operational object box nodes. If False, only process_names will be displayed on the top center of the operational object box nodes. However, If grouping is False, none of them will be displayed.
    • alias_dict: dict (default: None)
      Alias name dictionary for QUEEN_objects.project names. This will display the alias names instead of QUEEN_objects.project.

    Return

    graphviz.dot.Digraph object

    Example code 28: Visualization of the flow chart for pCMV-Target-AID construction

    (Expected runtime: less than 1 sec.)

    Source code (continued from the example code 24)

    graph_a = visualizeflow(pCMV_Target_AID, sf=False,ip=True, grouping=False)
    graph_b = visualizeflow(pCMV_Target_AID, sf=True, ip=True, grouping=False)
    graph_c = visualizeflow(pCMV_Target_AID, sf=True, ip=True, grouping=True, pd=True)
    graph_d = visualizeflow(pCMV_Target_AID) #default setting
    graph1.render("pCMV-Target-AID_flow1")
    graph2.render("pCMV-Target-AID_flow2")
    graph3.render("pCMV-Target-AID_flow3")
    graph4.render("pCMV-Target-AID_flow4")
    

    Output figures

Project details


Download files

Download the file for your platform. If you're not sure which to choose, learn more about installing packages.

Source Distributions

No source distribution files available for this release.See tutorial on generating distribution archives.

Built Distribution

python_queen-1.0.0-py3-none-any.whl (87.0 kB view hashes)

Uploaded Python 3

Supported by

AWS AWS Cloud computing and Security Sponsor Datadog Datadog Monitoring Fastly Fastly CDN Google Google Download Analytics Microsoft Microsoft PSF Sponsor Pingdom Pingdom Monitoring Sentry Sentry Error logging StatusPage StatusPage Status page