fuzzysearch is useful for finding approximate subsequence matches
Project description
Fuzzy search: Find parts of long text or data, allowing for some changes/typos.
Easy, fast, and just works!
>>> find_near_matches('PATTERN', '---PATERN---', max_l_dist=1)
[Match(start=3, end=9, dist=1, matched="PATERN")]Two simple functions to use: one for in-memory data and one for files
Fastest search algorithm is chosen automatically
Levenshtein Distance metric with configurable parameters
Separately configure the max. allowed distance, substitutions, deletions and/or insertions
Advanced algorithms with optional C and Cython optimizations
Properly handles Unicode; special optimizations for binary data
- Simple installation:
pip install fuzzysearch just works
pure-Python fallbacks for compiled modules
only one dependency (attrs)
Extensively tested
Free software: MIT license
For more info, see the documentation.
Installation
fuzzysearch supports Python versions 2.7 and 3.5+, as well as PyPy 2.7 and 3.6.
$ pip install fuzzysearchThis will work even if installing the C and Cython extensions fails, using pure-Python fallbacks.
Usage
Just call find_near_matches() with the sub-sequence you’re looking for, the sequence to search, and the matching parameters:
>>> from fuzzysearch import find_near_matches
# search for 'PATTERN' with a maximum Levenshtein Distance of 1
>>> find_near_matches('PATTERN', '---PATERN---', max_l_dist=1)
[Match(start=3, end=9, dist=1, matched="PATERN")]To search in a file, use find_near_matches_in_file() similarly:
>>> from fuzzysearch import find_near_matches_in_file
>>> with open('data_file', 'rb') as f:
... find_near_matches_in_file(b'PATTERN', f, max_l_dist=1)
[Match(start=3, end=9, dist=1, matched="PATERN")]Examples
fuzzysearch is great for ad-hoc searches of genetic data, such as DNA or protein sequences, before reaching for “heavier”, domain-specific tools like BioPython:
>>> sequence = '''\
GACTAGCACTGTAGGGATAACAATTTCACACAGGTGGACAATTACATTGAAAATCACAGATTGGTCACACACACA
TTGGACATACATAGAAACACACACACATACATTAGATACGAACATAGAAACACACATTAGACGCGTACATAGACA
CAAACACATTGACAGGCAGTTCAGATGATGACGCCCGACTGATACTCGCGTAGTCGTGGGAGGCAAGGCACACAG
GGGATAGG'''
>>> subsequence = 'TGCACTGTAGGGATAACAAT' # distance = 1
>>> find_near_matches(subsequence, sequence, max_l_dist=2)
[Match(start=3, end=24, dist=1, matched="TAGCACTGTAGGGATAACAAT")]BioPython sequences are also supported:
>>> from Bio.Seq import Seq
>>> from Bio.Alphabet import IUPAC
>>> sequence = Seq('''\
GACTAGCACTGTAGGGATAACAATTTCACACAGGTGGACAATTACATTGAAAATCACAGATTGGTCACACACACA
TTGGACATACATAGAAACACACACACATACATTAGATACGAACATAGAAACACACATTAGACGCGTACATAGACA
CAAACACATTGACAGGCAGTTCAGATGATGACGCCCGACTGATACTCGCGTAGTCGTGGGAGGCAAGGCACACAG
GGGATAGG''', IUPAC.unambiguous_dna)
>>> subsequence = Seq('TGCACTGTAGGGATAACAAT', IUPAC.unambiguous_dna)
>>> find_near_matches(subsequence, sequence, max_l_dist=2)
[Match(start=3, end=24, dist=1, matched="TAGCACTGTAGGGATAACAAT")]Matching Criteria
The search function supports four possible match criteria, which may be supplied in any combination:
maximum Levenshtein distance (max_l_dist)
maximum # of subsitutions
maximum # of deletions (“delete” = skip a character in the sub-sequence)
maximum # of insertions (“insert” = skip a character in the sequence)
Not supplying a criterion means that there is no limit for it. For this reason, one must always supply max_l_dist and/or all other criteria.
>>> find_near_matches('PATTERN', '---PATERN---', max_l_dist=1)
[Match(start=3, end=9, dist=1, matched="PATERN")]
# this will not match since max-deletions is set to zero
>>> find_near_matches('PATTERN', '---PATERN---', max_l_dist=1, max_deletions=0)
[]
# note that a deletion + insertion may be combined to match a substution
>>> find_near_matches('PATTERN', '---PAT-ERN---', max_deletions=1, max_insertions=1, max_substitutions=0)
[Match(start=3, end=10, dist=1, matched="PAT-ERN")] # the Levenshtein distance is still 1
# ... but deletion + insertion may also match other, non-substitution differences
>>> find_near_matches('PATTERN', '---PATERRN---', max_deletions=1, max_insertions=1, max_substitutions=0)
[Match(start=3, end=10, dist=2, matched="PATERRN")]When to Use Other Tools
Use case: Search through a list of strings for almost-exactly matching strings. For example, searching through a list of names for possible slight variations of a certain name.
Suggestion: Consider using fuzzywuzzy.
History
0.7.3 (2020-06-27)
Fixed segmentation faults due to wrong handling of inputs in bytes-like-only functions in C extensions.
0.7.2 (2020-05-07)
Added PyPy support.
Several minor bug fixes.
0.7.1 (2020-04-05)
Dropped support for Python 3.4.
Removed deprecation warning with Python 3.8.
Fixed a couple of nasty bugs.
0.7.0 (2020-01-14)
Added matched attribue to Match objects containing the matched part of the sequence.
Added support for CPython 3.8. Now supporting CPython 2.7 and 3.4-3.8.
0.6.2 (2019-04-22)
Fix calling search_exact() without passing end_index.
Fix edge case: max. dist >= sub-sequence length.
0.6.1 (2018-12-08)
Fixed some C compiler warnings for the C and Cython modules
0.6.0 (2018-12-07)
Dropped support for Python versions 2.6, 3.2 and 3.3
Added support and testing for Python 3.7
Optimized the n-grams Levenshtein search for long sub-sequences
Further optimized the n-grams Levenshtein search
Cython versions of the optimized parts of the n-grams Levenshtein search
0.5.0 (2017-09-05)
Fixed search_exact_byteslike() to support supplying start and end indexes
Added support for lists, tuples and other Sequence types to search_exact()
Fixed a bug where find_near_matches() could return a wrong Match.end with max_l_dist=0
Added more tests and improved some existing ones.
0.4.0 (2017-07-06)
Added support and testing for Python 3.5 and 3.6
Many small improvements to README, setup.py and CI testing
0.3.0 (2015-02-12)
Added C extensions for several search functions as well as internal functions
Use C extensions if available, or pure-Python implementations otherwise
setup.py attempts to build C extensions, but installs without if build fails
Added --noexts setup.py option to avoid trying to build the C extensions
Greatly improved testing and coverage
0.2.2 (2014-03-27)
Added support for searching through BioPython Seq objects
Added specialized search function allowing only subsitutions and insertions
Fixed several bugs
0.2.1 (2014-03-14)
Fixed major match grouping bug
0.2.0 (2013-03-13)
New utility function find_near_matches() for easier use
Additional documentation
0.1.0 (2013-11-12)
Two working implementations
Extensive test suite; all tests passing
Full support for Python 2.6-2.7 and 3.1-3.3
Bumped status from Pre-Alpha to Alpha
0.0.1 (2013-11-01)
First release on PyPI.
